Clinical Trials Logo

Clinical Trial Summary

Phase II, prospective, randomized, multicenter, open-label, pilot clinical trial comparing remote ischemic conditioning (RIC) plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible to recanalization therapies.


Clinical Trial Description

Funding: This study is supported by a grant from the Ministry of Health: PRIN 2017CY3J3W. This funding source had no role in the design of this study and will not have any role during its execution, analyses, interpretation of the data, reporting of the study or decision to submit results Background: Remote ischemic conditioning is an experimental therapy consisting in a transient ischemia applied in a certain body site, with the aim of increasing ischemic tolerance in distant organs through the activation of endogenous protective mechanisms. Ischemic per-conditioning is a sub-lethal ischemia applied while a harmful ischemia is ongoing, whereas ischemic post-conditioning is a sub-lethal ischemia applied subsequent to the occurrence of a harmful ischemia. Both of them have been proven to be neuroprotective to ischemic brain tissue in many exploratory single-centre pre-clinical studies. Although the neuroprotective mechanisms remain elusive, evidence supports the role of both humoral and neuronal factors, such as the release of adenosine, bradykinin and nitric oxide in the blood, the activation of neuronal p-AKT and of several miRNAs; a recent pre-clinical study, conducted on experimental rat model of acute ischemic stroke, also showed significantly increased mRNA levels of HIF-1α 24 hours after the application of remote ischemic conditioning, suggesting a possible neuroprotective role of HIF-1α. Remote ischemic conditioning represents a potential translational strategy; however, despite many pre-clinical exploratory studies highlighted its neuroprotective effect, only a few clinical trials have been conducted so far. RESCUE BRAIN is an ongoing multicenter clinical trial on remote ischemic conditioning applied within 6 hours of stroke onset through intermittent lower limb ischemia. The efficacy of remote ischemic conditioning has been assessed by measuring brain infarct growth from baseline to 24h through MRI DWI sequences and comparing brain infarct growth of a cohort of patients treated with remote ischemic conditioning plus standard medical therapy to that of a cohort treated with standard medical therapy alone. A potential limit of this trial is represented by the inclusion of stroke patients that received either or both thrombolysis and mechanical thrombectomy. In fact, as these treatments are highly effective if applied promptly, they may conceal the effect of remote ischemic conditioning when administered in addition to it, making it difficult to selectively investigate its efficacy. In a previous single-center clinical trial, remote ischemic per-conditioning, induced by intermittent upper arm ischemia, had been applied to patients with suspected acute ischemic stroke during transportation to hospital, as an adjunct to thrombolysis and prior to its administration. The efficacy of remote ischemic per-conditioning has been assessed by measuring penumbral salvage, final infarct size at 1 month, infarct growth at 1 month and evaluating clinical outcome after 3 months. Although the overall results were neutral, patients treated with remote ischemic per-conditioning showed lower NIHSS scores and higher frequency of TIA than controls, together with an overall reduction in risk of brain tissue infarction, suggesting a fast-acting neuroprotective effect; moreover, remote ischemic conditioning resulted to be safe and highly tolerable. The latter observation has also been confirmed in RECAST, a single-center study on tolerability and feasibility of remote ischemic conditioning applied to mildly symptomatic patients within 24h of stroke onset. The RECAST trial also demonstrated increased plasmatic levels of HSP27 at 4 days in the intervention group, suggesting its possible role in neuroprotection and indicating HSP27 as a potential biomarker of neuroprotection11. Based on these observations, the Italian Stroke Organization (ISO) Basic Science Network, which is a nationwide network that promotes translational research on acute ischemic stroke, launched a multicenter translational research program on remote ischemic conditioning. This program provided for a pre-clinical study on animal model of experimental ischemic stroke and a pilot clinical trial involving patients with acute ischemic stroke within 9 hours of stroke onset that are not eligible for recanalization therapies. Current guidelines for ischemic stroke recommend thrombolysis within 4.5 hours and thrombectomy within 6 hours of stroke onset for all eligible patients, but also allow administration of recanalization therapies beyond the abovementioned time window in selected patients, according to the results of DAWN, DEFUSE and WAKE-UP trial. The DAWN trial (Clinical Mismatch in the Triage of Wake Up and Late Presenting Strokes Undergoing Neurointervention With Trevo) used clinical-radiological mismatch to select patients with large anterior circulation vessel occlusion for mechanical thrombectomy 6 hours to 24 hours from last time known normal. The DEFUSE 3 trial (Diffusion and Perfusion Imaging Evaluation for Understanding Stroke Evolution) used perfusion-core mismatch and maximum core size as radiological criteria to select patients with large anterior circulation occlusion between 6 hours and 16 hours from last time known well for mechanical thrombectomy. Both trials demonstrated an overall benefit in functional outcome at 90 days in the subgroup of patients in the endovascular arm that were treated with mechanical thrombectomy >6 hours from onset. The WAKE-UP trial (MRI-Guided Thrombolysis for Stroke with Unknown Time of Onset) enrolled patients with stroke on awakening or with unclear time of onset, and that presented with MRI mismatch between abnormal signal on DWI and no abnormalities on FLAIR. The patient either noticed stroke symptoms on awakening or could not report the timing of symptom onset due to neurological deficits (e.g. aphasia, anathria, confusion); the time interval between the patient was last known to be well and symptom recognition was >4.5 hours (without upper limit) in order to exclude patients otherwise eligible to thrombolysis. This trial provided evidence of benefit from thrombolysis within 4.5 hours of stroke symptom recognition. Finally, the EXTEND trial (Thrombolysis Guided by Perfusion Imaging up to 9 Hours after Onset of Stroke) enrolled patients with stroke onset between 4,5 hours and 9 hours and those with stroke on awakening within 9 hours of the midpoint of sleep, who had salvageable brain tissue on perfusion imaging. This trial demonstrated that thrombolysis, performed between 4.5 and 9.0 hours after stroke onset or at the time the patient awoke with stroke symptoms (if within 9 hours of midpoint of sleep), resulted in a higher percentage of patients with no or minor neurologic deficits than those who were given placebo. These evidences lead to rethinking the paradigm "time is brain", adding greater consciousness that time on the ischemic process is relative: although the longer treatment is delayed, the worse the functional outcome, penumbral transformation into irreversible brain injury within a given time interval varies in relation to multiple factors. In this context, the aim of this study is to explore remote ischemic conditioning as a neuroprotective therapy in acute ischemic stroke within an extended time window of 9 hours of stroke onset. Primary objective: to assess whether RIC plus standard medical therapy, applied within 9 hours of ischemic stroke onset, is superior to standard medical therapy alone in obtaining early neurological improvement, defined as the percent change in the National Institute of Health stroke scale (NIHSS) between admission and 72 hours after randomization, in patients with acute ischemic stroke ineligible for recanalization therapies. Secondary objectives: - Evaluate intervention feasibility, i.e. estimate the proportion of patients randomized to the active arm of the trial who successfully complete the RIC treatment - Estimate the added impact of the RIC therapy on the following outcomes: early neurological improvement at 24 hours and 48 hours after randomization; neuroprotection based on blood and plasma biomarkers; degree of disability or dependence in the daily activities at three months assessed by the modified Rankin Scale Trial design: Phase II, prospective, block randomized, multicenter, open-label, clinical trial comparing with a 1:1 allocation ratio RIC plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis and/or thrombectomy. The primary null hypothesis of this trial is that there is no difference in early neurological improvement between RIC plus standard medical therapy and standard medical therapy alone. Study setting: The experimental intervention will be carried out in three Italian Comprehensive Stroke Centers belonging to ISO-associated academic hospitals, represented by ASST Monza-Ospedale San Gerardo di Monza (Università degli Studi di Milano-Bicocca), Azienda Ospedaliera Sant'Andrea (Università degli Studi la Sapienza di Roma), Ospedale di Avezzano (Università degli Studi dell'Aquila). Methods: Experimental Intervention 1. Intervention arm: RIC treatment arm plus standard medical therapy Remote ischemic conditioning will be applied immediately after randomization in the Emergency Department, through a standard blood pressure cuff placed around the non-paretic arm. The protocol includes 4 cycles of intermittent manually induced upper limb ischemia, alternating 5 minutes of inflation (20mmHg above systolic blood pressure) and 5 minutes of deflation. Patients randomized to remote ischemic conditioning will also receive standard medical therapy (see below). 2. Control arm: Standard medical therapy alone Standard medical therapy will be administered immediately after randomization in the Emergency Department. Standard medical therapy comprises single antiplatelet therapy, either aspirin given in a total dose ranging between 100 to 300 mg per day on days 1-5 and followed by aspirin 100mg/day on days 1-5 followed by aspirin 100mg/day, or Clopidogrel 75mg/day (at the discretion of the patient's attending physician), unless an indication for early anticoagulation (e.g. atrial fibrillation, mechanical heart valve, deep venous thrombosis, pulmonary embolism, antiphospholipid antibody syndrome, hypercoagulable state) or dual antiplatelet therapy (e.g. early carotid stenting) is present. All patients will receive standard deep venous thrombosis (DVT) prevention therapy together with appropriate treatment for blood pressure control, glycemic control and cholesterol reduction. Data collection For each eligible patient the following data will be recorded by a designated investigator: - Demographics (age, gender, ethnicity) - Cerebrovascular risk factors (hypertension, diabetes, hyperlipidemia, atrial fibrillation, previous stroke or TIA, ischemic heart disease, peripheral vascular disease) - Past medical/surgical history - Medications prior to randomization (antiplatelets, anticoagulant, antihypertensive, statins) - National Institute of Health Stroke Scale (NIHSS) prior to randomization, at 24h, 48h and 72h - Feasibility (proportion of patients able to terminate RIC) - Wong-Baker faces pain rating scale immediately after RIC and 72h after randomization - CT-head at randomization and within 72h of randomization - Etiology according to TOAST classification at the time of discharge - Disability at 3 months through modified Rankin Scale - Adverse events at 3 months Plasma Biomarkers in acute ischemic stroke patients: Drawing of 7 mL of peripheral venous blood will be performed at 24h and 72h after RIC. - HIF-1α mRNA levels at 24 hours. Total RNA will be extracted from whole blood and transcribed into cDNA. Quantitative reverse transcription polymerase chain reaction (HIF1a F, TCATCCAAG- GAGCCTTAACC; HIF-1a R, AAGCGACATAGTAGGGGCAC) will be performed (Takara Bio, CA, USA). GAPDH will be chosen as the housekeeping gene. - HSP27 plasma levels at 72 hours. Plasma will be obtained by centrifugation and stored at - 20°C. HSP27 (human) will be quantified using a colorimetric enzyme immunoassay (ELISA) kit (Enzo Life Sciences, Roma, Italy). Study duration The investigation will be conducted for an estimated duration of 3 years: - Phase 1. Administrative and ethical procedures: 10 months - Phase 2. Duration of patient enrolment: 18 months. - Phase 3. Follow-up period: 3 months from the date of randomization. - Phase 4. Database lock, statistical analysis and production of a scientific report: 32-36 month. - Planned start of enrolment: upon approval by the Ethics committee and reception of the signed contract. Study design This is a phase II, prospective, block randomized, multicenter, open-label, clinical trial comparing with a 1:1 allocation ratio RIC plus standard medical therapy to standard medical therapy alone, in patients with acute ischemic stroke within 9 hours of stroke onset that are not candidates for thrombolysis and/or thrombectomy. The primary null hypothesis is that there is no or negligible difference in clinical benefit between remote ischemic conditioning plus standard medical therapy and standard medical therapy alone. Sample size An estimated total sample size of 80 patients (40 patients in each arm) should yield 80% power to detect a clinically significant difference of 20% (40% in treatment vs. 20% in control arm) in the median percent change in NIHSS at 72 hours, considering a standard deviation of 30%, at two-sided statistical significance threshold of p = 0.05, when using a Wilcoxon-Mann-Whitney test. Randomization A randomization list stratified by center will be produced using a pseudo-random number generator. The result of the randomization will be delivered after personal data input in a web form. Statistical methods Descriptive analyses will be carried out using classification (number and percentages) in categorical variables and using moments and medians/quartiles in numerical variables. Primary analysis of treatment effect on the early neurological improvement will be analysed using a Wilcoxon-Mann-Whitney test. A secondary analysis on the primary outcome will be performed using a mixed linear regression including treatment and centers and unbalanced important baseline characteristics in case they are present. Feasibility will be measured estimating the proportion of subjects who terminate RIC, together with an exact 95% confidence limit. Description of adverse events will be reported for all randomized subjects. Population examined will be ITT. Cut-off for statistical significance will be set at 0.05, two-tailed. ;


Study Design


Related Conditions & MeSH terms


NCT number NCT04400981
Study type Interventional
Source University of Milano Bicocca
Contact Simone Beretta, MD, PhD
Phone +39 0392333568
Email simone.beretta@unimib.it
Status Recruiting
Phase N/A
Start date August 1, 2021
Completion date August 2024

See also
  Status Clinical Trial Phase
Recruiting NCT05196659 - Collaborative Quality Improvement (C-QIP) Study N/A
Recruiting NCT06027788 - CTSN Embolic Protection Trial N/A
Completed NCT03281590 - Stroke and Cerebrovascular Diseases Registry
Recruiting NCT05518305 - Platelet Expression of FcγRIIa and Arterial Hemodynamics to Predict Recurrent Stroke in Intracranial Atherosclerosis
Recruiting NCT06029959 - Stroke and CPAP Outcome Study 3 N/A
Recruiting NCT03728738 - Zero Degree Head Positioning in Hyperacute Large Artery Ischemic Stroke Phase 3
Terminated NCT03396419 - IMPACT- 24col Collateral Blood Flow Assessment Following SPG Stimulation in Acute Ischemic Stroke (ImpACT-24B Sub-Study)
Recruiting NCT05065216 - Treatment of Acute Ischemic Stroke (ReMEDy2 Trial) Phase 2/Phase 3
Recruiting NCT04897334 - Transcranial Direct Current Stimulation and Rehabilitation to Ameliorate Impairments in Neurocognition After Stroke N/A
Not yet recruiting NCT06462599 - Osteopontin Gene Polymorphism in Stroke Patients in Egypt
Not yet recruiting NCT06026696 - Cohort of Neurovascular Diseases Treated in the Acute Phase and Followed at Lariboisière
Not yet recruiting NCT06032819 - Differentiating Between Brain Hemorrhage and Contrast
Recruiting NCT02910180 - Genetic, Metabolic, and Growth Factor Repository for Cerebrovascular Disorders
Withdrawn NCT01866189 - Identification of Hypoxic Brain Tissues by F-MISO PET in Acute Ischemic Stroke N/A
Completed NCT02922452 - A Study to Evaluate the Effect of Diltiazem on the Pharmacokinetics (PK) of BMS-986141 in Healthy Subjects Phase 1
Completed NCT03554642 - Walkbot Robotic Training for Improvement in Gait Phase 3
Recruiting NCT03041753 - Reperfusion Injury After Stroke Study N/A
Completed NCT02549846 - AdminiStration of Statin On Acute Ischemic stRoke patienT Trial Phase 4
Completed NCT01678534 - Reparative Therapy in Acute Ischemic Stroke With Allogenic Mesenchymal Stem Cells From Adipose Tissue, Safety Assessment, a Randomised, Double Blind Placebo Controlled Single Center Pilot Clinical Trial Phase 2
Completed NCT02610803 - Paroxysmal Atrial Fibrillation in Patients With Acute Ischemic Stroke N/A