Periodontitis Clinical Trial
Official title:
A Randomized Controlled Clinical Trial on the Effectiveness of Three Different Mouthrinses, Adjunct to Periodontal Surgery, in Dental Plaque Control and Early Wound Healing
Aim: This study compared the effectiveness of three different mouthrinses (alcoholic and
non-alcoholic chlorhexidine, alkyl dimethyl glycine / alkyl dimethyl amine oxide - C31G) in
plaque control and early wound healing, postoperatively.
Materials and Methods: In this, randomized, double-blind, controlled clinical trial 42
patients were allocated to three groups assigned to two weeks rinsing after periodontal
surgery with C31G (group A), alcohol free chlorhexidine 0.12% (group B) or alcoholic
chlorhexidine 0.12% (group C). At weeks 1 and 2, plaque and early wound healing indices were
recorded. At day 14, total bacterial counts were estimated utilizing real - time qPCR.
Statistics included linear and generalized linear mixed models.
Materials and Methods
Patients' enrollment and all clinical procedures were conducted at the Department of
Periodontology, School of Dentistry, National and Kapodistrian University of Athens, Greece.
Clinical Procedures:
All surgical interventions were conducted by first and third year postgraduate residents.
Supragingival debridement and polishing of the operated area was performed immediately
before surgery. In cases of residual periodontal pocket elimination / reduction surgeries,
intrasulcular incisions followed by papilla preservation incisions at interdental areas were
applied. In crown lengthening cases, resective gingival incisions were applied in presence
of sufficient width of keratinized tissues (≥ 3mm). Following flap elevation, root surfaces
were thoroughly debrided with instruments and ultrasonic devices. Ostectomy / osteoplasty
with carbide burs was applied, as deemed appropriate. Buccal and palatal / lingual flaps
were fully adapted to each other and sutured together with monofilament slowly resorbable
suture. Periodontal dressings were not used. No systemic antibiotics were prescribed.
Ibuprofen 400mg, three times daily for 4 days, was suggested immediately after surgical
intervention. Smokers were advised to cease smoking for the first postsurgical week. Sutures
were removed at 7th postoperative day. During that period no accidental loss of sutures was
recorded.
Randomization and allocation concealment:
Subjects were randomly assigned to one of three groups using a computerized assignment
procedure (Random Sequence Generator, www.random.org) generated by the examiner A.G. Each
subject was given an identical number between 1 and 42. Participants received bottles with
one of the three solutions under investigation. Neither patients nor clinicians (surgeons
and examiner A.G.) were informed about the identity of mouthrinse administered in each case
(double - blind design). Masked bottles were given to participants by a third independent
person who was not a dentist (member of Postgraduate Clinic's assistance staff).
Post - surgical maintenance protocol:
During the first 14 postoperative days, participants were instructed to rinse with 15ml of
the administered solution for one minute, twice daily.
During the same period, subjects refrained from any mechanical plaque removal at the
operated areas.
Intra-examiner reproducibility:
Prior to the beginning of the study, the examiner (A.G.) who performed the measurements was
calibrated in order to establish intra - examiner reproducibility. Calibrations were
performed with two subjects not included in the study. During post-operative maintenance
using 0.12% chlorhexidine, at the 7th postsurgical day, early wound healing index (EHI) and
plaque index (PI) were recorded on two separate occasions during the same day, however at
least 8 hours apart. Intra-class correlation analysis was used to calculate intra-examiner
agreement for repeated measurements. The calibration was accepted if both measurements were
similar with a deviation of +/- 10% (intra-class correlation coefficient > 0.9).
Microbiological assessment:
Supragingival dental plaque pooled samples were collected at the 14th postoperative day from
both interproximal tooth surfaces respectively to the interdental papilla with the highest
EHI value, using curettes. Pooled samples were individually collected in 150μl TE buffer
solution. Samples were stored at -80 until processing, which was performed at the Laboratory
of Cell and Matrix Pathobiology at the Institute of Biosciences and Applications, National
Center for Scientific Research (N.C.S.R.), Athens, Greece. Bacterial genomic DNA was
isolated and purified using the PureLink® Genomic DNA Μini Kit, following the Gram (+)
bacterial cell lysis manufacturer's protocol. Purified DNA concentrations were determined
spectrophotometrically (NanoDrop 1000). Specimens were analyzed using quantitative real time
PCR (qPCR) in order to evaluate the total bacterial count in each pooled sample. qPCR was
conducted with application of a set of universal primers (forward primer: 5'
TCCTACGGGAGGCAGCAGT 3' and reverse primer: 5' GGACTACCAGGGTATCTAATCCTGTT 3', with an
amplicon size of 466 base pairs), reported to detect DNA sequences of gene encoding for 16S
ribosomal subunit of at least 50 different bacterial species (aerobic and anaerobic Gram
positive and Gram negative) and SYBR Green Ι fluorescent probe. Serial dilutions of DNA
extract of pure bacterial cultures of Escherichia coli were performed in order to generate a
standard curve for the qPCR. Reactions were performed for 40 cycles at 94 °C for 30 sec, 58
°C for 45 sec and 72 °C for 10 min in a Light Cycler 96 qPCR Device. Results were analyzed
using the Light Cycler 96 1.1 Software. Total bacterial count of each sample is expressed as
total bacterial DNA mass (ng) and bacterial copy numbers (x106).
Sample size calculation:
Sample size was estimated through one-way ANOVA based calculations, assuming that the
minimum clinically significant difference is one unit in median EHI values at 14 days
between at least one pair of groups. 14 patients for each group were needed for 80% power
achievement and for median differences detection in under evaluation parameters among the
groups.
Statistical analysis:
Demographic and clinical characteristics of the sample are presented by group in tables
containing absolute and relative (%) frequencies for categorical variables and medians and
interquartile ranges (Median - IQR) for quantitative variables. Between groups differences
in these characteristics were assessed through Fisher's exact tests for categorical
variables and Kruskal-Wallis tests for quantitative ones. The distributions of the indices
of interest (Early wound healing index - EHI, Plaque index - PI, Plaque area index - PA%)
were summarized through medians and IQRs.
Indices' data were analyzed through linear or generalized linear mixed models taking into
account the potential correlations between multiple measurements taken on the same
individual. In particular, for the analysis of EHI and PI, ordinal logistic regression
models were used. For the PA% index, which was a proportion ranging from 0% to 100%, a
linear model was used after a logit transformation of the dependent variable. Model
selection, including checks for potential interaction effects, for the final multivariable
models was based on likelihood ratio tests.
Total microbial count differences among groups or in relation to other sample
characteristics were analyzed using linear regression model after log10 transformation.
Results are presented as relative differences %.
P-values less than 0.05 were considered statistically significant. All analyses were
performed using the statistical package Stata 13.1 (Stata Corp., USA).
;
| Status | Clinical Trial | Phase | |
|---|---|---|---|
| Completed |
NCT04712630 -
Non-Incised Papillae Surgical Approach (NIPSA) With and Without Graft
|
N/A | |
| Completed |
NCT06127069 -
Treatment of Residual Pockets in Periodontal Patients Using an Oscillating Chitosan Device
|
N/A | |
| Completed |
NCT04964167 -
Indocyanine-green Mediated Photosensitizer VS Aloe Vera Gel: Adjunct Therapy to Scaling and Root Planing in Patients With Chronic Periodontitis
|
Phase 4 | |
| Completed |
NCT05906797 -
Impact of Non-surgical Periodontal Therapy in the Improvement of Early Endothelial Dysfunction in Subjects With Periodontitis.
|
N/A | |
| Recruiting |
NCT03997552 -
NIPSA Versus Marginal Approach by Palatal Incision and MIST in Periodontal Regeneration
|
N/A | |
| Completed |
NCT05530252 -
Effects of AMP Application After Non-surgical Periodontal Therapy on Treatment of Periodontitis
|
Phase 4 | |
| Completed |
NCT04881357 -
Antiplaque/Antigingivitis Effect of Lacer Oros Integral
|
N/A | |
| Recruiting |
NCT03790605 -
A Clinical Trial to Study the Effect of a Drug, Curcumin in Patients With Periodontitis
|
Phase 3 | |
| Enrolling by invitation |
NCT04971174 -
Outcomes of Periodontal Regenerative Treatment
|
||
| Not yet recruiting |
NCT05568290 -
Interleukin-38 Levels in Individuals With Periodontitis
|
||
| Completed |
NCT04383561 -
Relationship Between LRG and Periodontal Disease
|
N/A | |
| Recruiting |
NCT03997578 -
Non-incised Papillae Surgical Approach (NIPSA) and Connective Tissue Graft Plus Emdogain for Periodontal Defects
|
N/A | |
| Completed |
NCT03901066 -
Smoking Dependence and Periodontitis
|
||
| Enrolling by invitation |
NCT04956211 -
Periodontal Treatment and Ischemic Stroke
|
N/A | |
| Recruiting |
NCT05971706 -
Ozone Application in Periodontal Treatment
|
N/A | |
| Recruiting |
NCT06099574 -
A Study on the Oral Health Status of Pregnant Women With Gestational Diabetes and Its Correlation With Oral Flora
|
||
| Completed |
NCT04402996 -
Meteorin-like Levels in Individuals With Periodontitis
|
||
| Active, not recruiting |
NCT05311657 -
Oral Health and Severe COPD
|
||
| Not yet recruiting |
NCT06453278 -
(DDS) in India: a Screening Tool to Identify Prediabetes and Undiagnosed Type 2 Diabetes in Dental Settings
|
||
| Not yet recruiting |
NCT05643287 -
The Effect of Time on the Outcome of Periodontal Treatment.
|
N/A |