Adult Respiratory Distress Syndrome Clinical Trial
Official title:
Polymorphism of the Angiotensin-Converting Enzyme Gene and the Outcome of Acute Respiratory Distress Syndrome
The acute respiratory distress syndrome (ARDS) is an important cause of acute respiratory failure with a high mortality rate. The mechanism of resolution of the late organizing phase remains uncertain. The ACE gene contains a polymorphism based on the presence (insertion, I) or absence (deletion, D) within an intron of a 287-bp nonsense DNA domain, resulting in three genotypes (DD and II homozygotes, and ID heterozygotes). It has been shown that I/D polymorphism of ACE gene may account for half the variance of serum ACE levels in the Caucasians. Polymorphism of the ACE gene has also been shown to contribute to the development of some respiratory diseases. We hypothesize that the presence of ACE gene polymorphism can affect the outcome of ARDS. The objective of this proposed study is to determine the genotypes of ACE gene polymorphism and assess the influence of ACE genotype on the outcome and pulmonary resolution of patients with ARDS. Patients diagnosed to have ARDS are eligible for possible inclusion into the study. The ACE genotype of all patients with ARDS will be determined by polymerase chain reaction (PCR) amplification of the respective fragment for the D and I alleles from intron 16 of the ACE gene and size fractionation by electrophoresis. The outcome of patients with ARDS in the three genotypes will be compared.
Study Design. This was a observational study of patients with ARDS. The study was reviewed
and approved by the Institutional Review Board of the National Taiwan University Hospital.
Patients admitted to the medical ICU at the National Taiwan University Hospital were
screened for eligibility. Patients were considered eligible if they were over 18 years of
age and fulfilled the American-European Consensus Committee criteria for ARDS: a) acute
onset; b) bilateral pulmonary infiltrates; c) severely impaired oxygenation, i.e., PaO2/FIO2
< 200 mmHg; and d) pulmonary artery occlusion pressure < 18 mmHg or no evidence of left
atrial hypertension (1).
Exclusion criteria were: a) a previous history of ARDS; b) received angiotensin-converting
enzyme inhibitor or angiotensin receptor antagonist within one month before the development
of ARDS; c) receiving mechanical ventilation due to chronic respiratory failure; and d) did
not receive invasive mechanical ventilation after the occurrence of ARDS. If a patient had
repeated episodes of ARDS during the study period, only the first episode would be studied
and included for analysis. The diagnosis of sepsis was based on the criteria by the American
College of Chest Physicians/Society of Critical Care Medicine Consensus Conference Committee
(21).
In addition, two control groups, consisting “at-risk” patients and “non-at-risk”,
respectively, were recruited for comparison. The patients in the “at-risk” group were all
admitted to the MICU due to acute respiratory failure but did not meet the diagnostic
criteria of ARDS throughout the hospital course. The “non-at-risk” group had no previous
history of respiratory failure or admission to the ICU for any reason, and had not been
hospitalized within 6 months before inclusion.
Clinical Data Collection and Outcome. For the ARDS and at-risk groups, the following data
were collected on admission to the ICU: co-morbidities, Acute Physiology and Chronic Health
Evaluation (APACHE II) scores (22), gender, age, and reason for admission. For the ARDS
groups, the Lung Injury Scores (LIS) were measured at the time of diagnosis of ARDS(23). For
the at-risk group, the highest lung LIS’s were also recorded. During the MICU admission, the
best PaO2/FIO2 and the mode of mechanical ventilation were recorded daily and major organ
functions (serum creatinine, blood cell and platelet counts, serum alanine aminotransferase)
were regularly determined. Decisions on specific supportive treatments for ARDS (prone
positioning, inhaled nitric oxide, high-frequency oscillation ventilation, etc.), weaning
and extubation were determined by the attending physicians according to the clinical
condition and test for eligibility of extubation. The primary outcome of this study was the
survival at the 28th day of ARDS onset. The secondary outcome was the survival on hospital
discharge.
ACE Polymorphism. After informed consents were obtained from the patients and control
subjects, peripheral blood samples were obtained and enediaminetetraacetic acid (EDTA) was
added. Genomic DNA was extracted using commercial kits (QIAamp DNA Blood Mini Kit, Qiagen,
Valencia, CA) according to the manufacturer’s instructions and stored at -20˚C at a
concentration of 100 ng/L until further genotyping studies. The ACE I/D genotypes were
determined by PCR amplification of the respective fragments for the D and I alleles from
intron 16 of the ACE gene and by size fractionation by electrophoresis as previously
described elsewhere (24). Standard PCR was performed with 20 pmol of each primer
(5’CTGGAGACCACTCCCATCCTTTCT3’ and 5’GATGTGGCCATCACATTCGTCAGAT3’) in a final volume of 25 L,
containing 1.5 mM MgCl2, 50 mM KCl, 10 mM Tris-HCl pH 8.3, 0.2 mM of each dNTP, and 1.25
units if Taq polymerase (Perkin Elmer-Cetus; Norwalk, Conn). The DNA was amplified for 30
cycles with denaturation at 94˚C for 30 s, annealing at 58˚C for 30 s, and extension at 72˚C
for 1 min, followed by final extension at 72˚C for 5 min (DNA Thermal Cycler 480; Perkin
Elmer-Cetus). The PCR products were electrophoresed in a 2% agarose gels with 5 g of
ethidium bromide/mL, and were identified by 300-nm ultraviolet transillumination as distinct
bands (D allele: 191 bp; I allele: 478 bp). Because of the concerns about mistyping ID as
DD, all samples found to have the DD genotype were subjected to a second, independent PCR
amplification with a primer pair that recognizes an insertion-specific sequence
(5’TGGGACCACAGCGCCCGCCACTAC’3 and 5’TCGCCAGCCCTCCCATGCCCATAA’3) (25). The PCR condition has
been described elsewhere(25). The reaction yields a 335-bp amplicon only in the presence of
an I allele, and no product in samples homozygous for DD.
Statistical Analysis. The SPSS statistical package (version 10.1 for Windows; SPSS, Chicago,
IL) was used for most of the statistical analyses. Continuous data were expressed as means
SD. Comparisons of the continuous data were performed by ANOVA or two-sample t tests. The
chi-square tables were used to compare the observed number of each genotype with those
expected for a population in a Hardy-Weinberg equilibrium and to compare genotype
frequencies between the ARDS population and the control groups. The 28-day survival and
survival on hospital discharge between the genotypes were estimated by the Kaplan-Meier
method, and the statistical significances were tested using the log-rank test. Multivariate
analyses for the primary and secondary outcomes were performed by the Cox proportional
hazard methods. For all tests, a p value of 0.05 or less was considered significant.
;
Allocation: Random Sample, Observational Model: Natural History, Time Perspective: Cross-Sectional
| Status | Clinical Trial | Phase | |
|---|---|---|---|
| Terminated |
NCT01722422 -
Hyperoxia and Hypertonic Saline in Septic Shock
|
N/A | |
| Withdrawn |
NCT01195428 -
Simvastatin Effect on the Incidence of Acute Lung Injury/Adult Respiratory Distress Syndrome (ALI/ARDS)
|
N/A | |
| Terminated |
NCT01901354 -
Acute Lung Injury Ventilator Evaluation (ALIVE)
|
N/A | |
| Withdrawn |
NCT00793013 -
Airway Pressure Release Ventilation (APRV) Compared to ARDSnet Ventilation
|
Phase 2 | |
| Terminated |
NCT01667666 -
Clinical Trial of Nebulized Hypertonic Saline to Attenuate Post-Traumatic Acute Lung Injury
|
Phase 1 | |
| Completed |
NCT00314548 -
Inhaled Prostacyclin for Adult Respiratory Distress Syndrome (ARDS) and Pulmonary Hypertension
|
N/A | |
| Completed |
NCT04390139 -
Efficacy and Safety Evaluation of Mesenchymal Stem Cells for the Treatment of Patients With Respiratory Distress Due to COVID-19
|
Phase 1/Phase 2 | |
| Withdrawn |
NCT01083355 -
Assessing Respiratory Variability During Mechanical Ventilation in Acute Lung Injury (ALI)
|
N/A | |
| Completed |
NCT03946150 -
PaO2/FiO2*PEEP (P/FP) Ratio and Mortality in Acute Respiratory Distress Syndrome.
|
||
| Terminated |
NCT04778059 -
Safety and Efficacy of USB002 for Respiratory Distress Due to COVID-19
|
Phase 2 | |
| Terminated |
NCT01038531 -
Biomarkers of Lung Injury With Low Tidal Volume Ventilation Compared With Airway Pressure Release Ventilation
|
N/A | |
| Recruiting |
NCT04079426 -
Tetracycline to Limit the Innate Immune Response in Acute Respiratory Distress Syndrome
|
||
| Terminated |
NCT01769053 -
Variable Pressure Support Trial
|
N/A | |
| Completed |
NCT02804945 -
Mesenchymal Stem Cells (MSCs) for Treatment of Acute Respiratory Distress Syndrome (ARD) in Patients With Malignancies
|
Phase 1 | |
| Completed |
NCT00465309 -
Protective Ventilation With Carbon Dioxide (CO2) -Removal Technique in Patients With Adult Respiratory Distress Syndrome (ARDS)
|
Phase 3 |