Clinical Trials Logo

Clinical Trial Summary

Background : Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters. Objective : To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults. Method: A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention Hypothesis: Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.


Clinical Trial Description

Method: 1. Non Randomized clinical trial with double-blind 2. Participants will be recruited consecutively 3. Matching technique will be applied following several variables adjustment 4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group Sample size calculation: The difference between two independent means sample size calculation is applied following the elements below: a. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14 Intervention : 1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg. 2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where : anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9 Control a. Active comparator using citric acid and sorbitol mixture Biological sample: 1. Serum sample preparation : Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C. 2. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below : 1. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC), 2. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)), 3. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA), 4. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA), 5. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA) Protection of Human subject according to Helsinki Declaration 1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects. 2. Possible side effect including : 3. Participants are allowed to withdraw from the study for any reason. Statistical Analysis Plan 1. Descriptive statistic of the baseline 2. The bivariate analysis between all variables and the outcomes 3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups 4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups 5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects. ;


Study Design


Related Conditions & MeSH terms


NCT number NCT04827628
Study type Interventional
Source Hasanuddin University
Contact Bumi Herman, Ph.D
Phone +66638275008
Email bumiherman@med.unhas.ac.id
Status Not yet recruiting
Phase N/A
Start date April 10, 2021
Completion date June 1, 2021

See also
  Status Clinical Trial Phase
Recruiting NCT04243317 - Feasibility of a Sleep Improvement Intervention for Weight Loss and Its Maintenance in Sleep Impaired Obese Adults N/A
Recruiting NCT04101669 - EndoBarrier System Pivotal Trial(Rev E v2) N/A
Terminated NCT03772886 - Reducing Cesarean Delivery Rate in Obese Patients Using the Peanut Ball N/A
Completed NCT03640442 - Modified Ramped Position for Intubation of Obese Females. N/A
Completed NCT04506996 - Monday-Focused Tailored Rapid Interactive Mobile Messaging for Weight Management 2 N/A
Recruiting NCT06019832 - Analysis of Stem and Non-Stem Tibial Component N/A
Active, not recruiting NCT05891834 - Study of INV-202 in Patients With Obesity and Metabolic Syndrome Phase 2
Active, not recruiting NCT05275959 - Beijing (Peking)---Myopia and Obesity Comorbidity Intervention (BMOCI) N/A
Recruiting NCT04575194 - Study of the Cardiometabolic Effects of Obesity Pharmacotherapy Phase 4
Completed NCT04513769 - Nutritious Eating With Soul at Rare Variety Cafe N/A
Withdrawn NCT03042897 - Exercise and Diet Intervention in Promoting Weight Loss in Obese Patients With Stage I Endometrial Cancer N/A
Completed NCT03644524 - Heat Therapy and Cardiometabolic Health in Obese Women N/A
Recruiting NCT05917873 - Metabolic Effects of Four-week Lactate-ketone Ester Supplementation N/A
Active, not recruiting NCT04353258 - Research Intervention to Support Healthy Eating and Exercise N/A
Completed NCT04507867 - Effect of a NSS to Reduce Complications in Patients With Covid-19 and Comorbidities in Stage III N/A
Recruiting NCT03227575 - Effects of Brisk Walking and Regular Intensity Exercise Interventions on Glycemic Control N/A
Completed NCT01870947 - Assisted Exercise in Obese Endometrial Cancer Patients N/A
Recruiting NCT05972564 - The Effect of SGLT2 Inhibition on Adipose Inflammation and Endothelial Function Phase 1/Phase 2
Recruiting NCT06007404 - Understanding Metabolism and Inflammation Risks for Diabetes in Adolescents
Recruiting NCT05371496 - Cardiac and Metabolic Effects of Semaglutide in Heart Failure With Preserved Ejection Fraction Phase 2