Acute Disease Clinical Trial
Official title:
Telomere Length in Relation to Acute Stress Response in Critical Care Patients
the investigators studied the impact of severe stress (in this case any event or illness leading to a necessity of critical care) on telomere length.
Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in
the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For
patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge
day. The blood sample processing was as follows: 5 ml of blood was collected and the red
blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit
Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for
mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out
procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase
chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop
device (Thermo Fisher, USA).
DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20]
with slight modifications. Each DNA sample was analyzed by two sets of primers detailed
below, one for telomere length analysis and one for a reference gene analysis (human
hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA
samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:
telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg:
ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT
hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG
Reaction PCR were processed as follows:
50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles
of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were
performed using the Step One device (ABI, USA).
;
| Status | Clinical Trial | Phase | |
|---|---|---|---|
| Completed |
NCT03832257 -
Improving Safety of Transitions to Skilled Nursing Care Using Videoconferencing
|
N/A | |
| Completed |
NCT02917213 -
Imaging Silent Brain Infarct And Thrombosis in Acute Myocardial Infarction
|
||
| Completed |
NCT00186342 -
Sibling and Unrelated Donor Hematopoietic Cell Transplant in Hematologic Malignancies
|
N/A | |
| Recruiting |
NCT04615065 -
Acutelines: a Large Data-/Biobank of Acute and Emergency Medicine
|
||
| Completed |
NCT02568475 -
Involving Nursing Home Residents and Their Families in Acute Care Transfer Decisions
|
N/A | |
| Terminated |
NCT00563654 -
Randomized Trial Comparing Alfuzosin GITS 10 mg Daily With Placebo for Trial Without Catheter in Acute Urinary Retention With Long Term Follow up
|
N/A | |
| Terminated |
NCT00073372 -
A Study of Effectiveness and Safety of Abciximab in Patients With Acute Ischemic Stroke (AbESTT-II)
|
Phase 3 | |
| Recruiting |
NCT05708768 -
Digital, Innovative, Sustainable, and Knowledge-based Acute Municipal Healthcare Services Illness and Trauma
|
||
| Completed |
NCT04571021 -
Implementation of the Individual Danish Emergency Process Triage
|
N/A | |
| Suspended |
NCT04519086 -
The Optimization of a Low-dose CT Protocol in Patients With Suspected Uncomplicated Acute Appendicitis and BMI >30
|
N/A | |
| Recruiting |
NCT02688244 -
Irrigation Versus Suction in Complicated Acute Appendicitis
|
N/A | |
| Completed |
NCT02474277 -
How Well Does the 30-Second Chair Stand Test Predict Rehabilitation Needs in Acutely Admitted Elderly Patients
|
N/A | |
| Recruiting |
NCT02422901 -
A Long-term Study to Describe the Use of PASCORBIN® 7.5 g in Patients With Vitamin C Deficiency
|
||
| Completed |
NCT01278199 -
Bronchial Artery Embolization and Medical Measures in Non Severe Acute Hemoptysis of Mild-moderate Abundance
|
N/A | |
| Recruiting |
NCT05506683 -
Improving Nighttime Access to Care and Treatment; Part 2- Ghana
|
N/A | |
| Recruiting |
NCT06421246 -
Activity in Geriatric Patients and Validation of the Danish Version of the Acute Care Mobility Assessment
|
||
| Completed |
NCT02912624 -
Simple Intensive Care Studies I (SICS-I)
|
||
| Recruiting |
NCT02800122 -
PAthwAy of Dyspneic patIent in Emergency (PArADIsE)
|
||
| Completed |
NCT02915640 -
Use of a Mobile Remote Device to Optimize Pediatric Inter-facility Transportation: A Feasibility Study
|
N/A | |
| Completed |
NCT01050478 -
IMPACT: A Study to Explore the Efficacy and Safety of Paliperidone ER in Patients With Acute Agitation
|
Phase 4 |