Clinical Trials Logo

Clinical Trial Details — Status: Completed

Administrative data

NCT number NCT03556176
Other study ID # 2.331.601
Secondary ID
Status Completed
Phase N/A
First received
Last updated
Start date July 30, 2018
Est. completion date May 15, 2020

Study information

Verified date May 2020
Source Universidade Federal de Goias
Contact n/a
Is FDA regulated No
Health authority
Study type Interventional

Clinical Trial Summary

The Influence of 5-HTTLPR and BDNF Polymorphisms on Anxiety and Mood After Acute Exercise.

Introduction: The 5-HTTLPR (SLC6A4) and BDNF (Val66Met) polymorphism presents an action on the modulation of human behavior and has received great attention as a risk factor for several psychiatric disorders. In recent years, a growing number of studies have evaluated the association between these polymorphisms and personality traits related to anxiety and depression. Objectives: To determine the frequencies of 5-HTTLPR and BDNF polymorphisms in a college students population; To determine the influence of 5-HTTLPR and BDNF polymorphisms on mood states and anxiety after acute physical exercise. Material and Methods: Four hundred (400) College students will be assessed.

In the first phase of the study, the following procedures will be performed: Screening, Aerobic Fitness Assessment (Step Test), Questionnaires (PAR-Q, Habitual Physical Activity Level, Beck Anxiety and Depression Scale, State-Trait Anxiety, and Perceived Stress Scale), blood sample collection and genotyping. In the second phase of the study, two (2) groups with or without polymorphisms will be selected (for each gene). These groups will be submitted to four conditions (three experimental conditions and one control condition), carried out randomly and separated by an interval of 1 week. In the experimental Conditions the volunteers will perform treadmill exercises sessions (30 minutes) in three different intensities (light, moderate and vigorous) and will respond to the Borg Scale at 10, 20 e 30 minutes. In the control condition the volunteers will be instructed to remain seated (quiet rest), relaxed and silent for 30 minutes. In both conditions, the volunteers will complete the Profile of Mood States (POMS) and State-Anxiety (STAY), 05 (five) minutes before and, 5 (five) and 20 (twenty) minutes following the interventions.


Recruitment information / eligibility

Status Completed
Enrollment 180
Est. completion date May 15, 2020
Est. primary completion date October 1, 2019
Accepts healthy volunteers Accepts Healthy Volunteers
Gender All
Age group 18 Years to 30 Years
Eligibility Inclusion criteria:

- 18-30 years of age;

- able to perform physical activities;

Non-inclusion criteria:

- history of cardiovascular or respiratory diseases;

- smoking;

- use of psychiatric drugs;

- psychotherapy treatment in the last six months.

Study Design


Related Conditions & MeSH terms


Intervention

Behavioral:
Exercise
Three exercises sessions - 30 min (light: 45 - 50%, moderate: 65 -70% and vigorous: 85 - 90% Heart Rate Maximal).
Quiet rest
Quiet rest during 30 min

Locations

Country Name City State
Brazil UFG Jataí Goiás

Sponsors (1)

Lead Sponsor Collaborator
Universidade Federal de Goias

Country where clinical trial is conducted

Brazil, 

Outcome

Type Measure Description Time frame Safety issue
Primary Response of mood states after interventions The POMS questionnaire is an instrument to evaluate mood states. It has 65 items and 6 domains: tension-anxiety, depression, anger-hostility, vigour-activity, fatigue, and confusion- bewilderment. The total mood disturbance score is derived by subtracting the vigour-activity score from the the sum of scores from the other subscales. The iceberg profile is characterized by low raw scores on the tension, depression, anger, fatigue, and confusion scales and above norms (the "water line") on vigor. Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
Primary Response of anxiety after interventions Anxiety Inventory-STAI trait-state. The scales encompasses 20 items and provides a one-dimensional measurement of anxiety. Range of scores for each subtest is 20-80, the higher score indicating greater anxiety. A cut point of 39-40 has been suggested to detect clinically significant symptoms. Change from 5 minutes before the treatments to 5 and 20 minutes after three exercise intensities and quiet rest
Secondary Evaluation safety or possible risk of exercising The Physical Activity Readiness Questionnaire (PAR-Q) was originally designed as a screening questionnaire to be self-administered before beginning physical activity. It has been designed to identify the small number of adults for whom physical activity may be inappropriate or those who should have medical advice concerning the type of activity most suitable for them.The people who to answer yes to one or more of seven questions will be advised to consult their doctors before increasing their physical activity. Those who to answer no to all questions will be included in the protocol study. baseline
Secondary Habitual Physical Activity Level Habitual Physical Activity Level (BAECKE):The Baecke Questionnaire was developed to measure habitual physical activity. The questionnaire includes items about household activities, sport, and leisure time activities over the past year. The Sport Index is divided into four categories (<1 h; 1-2 hrs; 2-3 hrs; 3-4 hrs and > 4 hrs) and each of these categories has an appropriate coefficient (0.5; 1.5; 2.5; 3.5 and 4.5) Usual daily activity and leisure activity are scored in a range of from 0 to 5. Global PA will be the sum of 3 indexes. Baseline
Secondary Evaluation of depression and anxiety symptoms Beck Inventory Anxiety and Depression: The Beck Depression and Anxiety Inventory consists of a self-report questionnaires. These instruments are used to measure the severity of depressive and anxiety episodes.These instruments are widely used by health professionals and researchers in a variety of clinical and research settings.
In the Beck Depression Inventory normal score are between 0 and 15; medium depression scores from 15 to 20 (dysphoria), and high depression scores over 20, and in the Beck Anxiety Inventory: 0-9: normal to minimal anxiety;10-18: mild to moderate anxiety;19-29: moderate to severe anxiety and 30-63: severe anxiety.
Baseline
Secondary Estimation the aerobic capacity McArdle Step Test was developed to estimate the aerobic capacity of university students. For the test the individual must ascend and descend a step during 3 min with different stepping rates for women and men (22 and 24 steps/min, respective Baseline
Secondary Detection of the polymorphism in the SLC6A4 The detection of the polymorphism in the SLC6A4 gene will be done by the PCR-RFLP method: restriction fragment length polymorphism (RFLP), in which the PCR amplification of the flanking region of the SNP is followed by the digestion reaction with a specific restriction enzyme.
The polymorphism of the SLC6A4 gene will be determined by the Polymerase Chain Reaction (PCR) and subsequent gel electrophoresis. PCR will be performed with the following primers forward (GGCGTTGCCGCTCTGAATGC) and reverse (GAGGGACTGAGCTGGACAACCAC).
Baseline
Secondary Detection of the polymorphism BDNF Val66Met SNP rs6265 genotype (G196A) The BDNF Val66Met SNP rs6265 genotype (G196A) will be obtained, using a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method with forward (5'-ACTCTGGAGAGCGTGAAT-3') and reverse (5'-ATACTGTCACAC ACGCTC-3') primers, and further digestion of the PCR product with NlaIII enzyme (Cat. No. R0125S, New England Biolabs).
From the five possible restriction fragments for this Val66Met amplicon, the genotype will be identified by the size and distribution of three bands: 243 bp for the G variant (Val), 168 bp and 75 bp bands for the A variant (Met), and these three bands for GA heterozygotes (Val/Met), on 2.5% (w/v) agarose gel electrophoresis.
Baseline
See also
  Status Clinical Trial Phase
Recruiting NCT05156424 - A Comparison of Aerobic and Resistance Exercise to Counteract Treatment Side Effects in Men With Prostate Cancer Phase 1/Phase 2
Completed NCT05108181 - Muscle Typology and Strength Training Adaptations N/A
Recruiting NCT05052918 - The Effect of Exercise and Metformin on Carotid Intima-media Thickness in Patients With Prediabetes N/A
Completed NCT04508270 - Significance of Early Mobilization After VATS-L
Recruiting NCT04994340 - Physical Activity Observatory of Castilla-La Mancha
Completed NCT04815980 - Impact of Pilates on Running Mechanics N/A
Completed NCT05189795 - The Construction of Physical ACtivity Enhancement Scheme (PACES) in Hemodialysis Patients
Completed NCT03683758 - Effects of the FIFA11+ Warm-up Program on Speed, Agility, and Vertical Jump Performance in Adult Female Amateur Soccer Players N/A
Completed NCT05538520 - Effects of Pilates Stretching on Flexibility, Strength, Power and Muscular Endurance N/A
Completed NCT06315036 - Effects of Developmental Gymnastics on Preschoolers' Motor Skills N/A
Completed NCT03171064 - Exercise as a Supportive Measure for Patients Undergoing Checkpoint-inhibitor Treatment Phase 2
Recruiting NCT05496751 - Response Variability to Exercise N/A
Not yet recruiting NCT05029804 - Effect of Walking Exercise Training on Adherence to Disease Management and Metabolic Control in Diabetes N/A
Completed NCT04207359 - Effects of Creatine Supplementation in Breast Cancer Survivors N/A
Completed NCT04099654 - The Effect of Core Stabilization Exercise Program in Obese Subjects Awaiting Bariatric Surgery N/A
Completed NCT03832205 - Validation of Respiratory Rate and Heart Rate Measurements by Capaciflectors Placed in Four Locations on the Chest
Completed NCT03477188 - The Effects of Somatosensory and Vestibular Rehabilitation Additional Conventional Therapy on Balance in Patients With Acute Stroke. N/A
Completed NCT03297567 - Physical Therapy Guidelines For Hospitalized Elderly N/A
Recruiting NCT05956327 - Insight Into Hippocampal Neuroplasticity in Schizophrenia by Investigating Molecular Pathways During Physical Training N/A
Recruiting NCT06018311 - Exercising Together for Hispanic Prostate Cancer Survivor-Caregiver Dyads N/A