Clinical Trials Logo

Clinical Trial Details — Status: Completed

Administrative data

NCT number NCT05269901
Other study ID # 2022/2/21
Secondary ID
Status Completed
Phase
First received
Last updated
Start date January 20, 2021
Est. completion date January 1, 2022

Study information

Verified date February 2022
Source Affiliated Hospital of Jiangnan University
Contact n/a
Is FDA regulated No
Health authority
Study type Observational

Clinical Trial Summary

Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.


Description:

To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4)dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11(SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.


Recruitment information / eligibility

Status Completed
Enrollment 40
Est. completion date January 1, 2022
Est. primary completion date November 15, 2021
Accepts healthy volunteers Accepts Healthy Volunteers
Gender All
Age group 6 Years to 12 Years
Eligibility Seizure group Inclusion Criteria: 1. Aged between 6 and 12 years old 2. Newly diagnosed untreated epilepsy Exclusion Criteria: 1. Treated with medicine or another therapy 2. Had history of cancer diseases 3. Had history of endocrine diseases Healthy control group Inclusion Criteria: 1. Aged between 6 and 12 years old Exclusion Criteria: 1. Had history of epilepsy 2. Had history of cancer diseases 3. Had history of endocrine diseases

Study Design


Related Conditions & MeSH terms


Intervention

Genetic:
SLC7A11, GPX4, P53
Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups

Locations

Country Name City State
China Affiliated Hospital of JiangNan University, Department of Pediatrics Wuxi Jiangsu

Sponsors (1)

Lead Sponsor Collaborator
Affiliated Hospital of Jiangnan University

Country where clinical trial is conducted

China, 

Outcome

Type Measure Description Time frame Safety issue
Primary Rt-qPCR Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:
GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC
Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.
Secondary Western blot Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53. Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.
See also
  Status Clinical Trial Phase
Completed NCT04595513 - Stopping TSC Onset and Progression 2: Epilepsy Prevention in TSC Infants Phase 1/Phase 2
Completed NCT02909387 - Adapting Project UPLIFT for Blacks in Georgia N/A
Completed NCT05552924 - Self Acupressure on Fatigue and Sleep Quality in Epilepsy Patients N/A
Terminated NCT01668654 - Long-term, Open-label Safety Extension Study of Retigabine/Ezogabine in Pediatric Subjects (>= 12 Years Old) With POS or LGS Phase 3
Not yet recruiting NCT05068323 - Impact of Interictal Epileptiform Activity on Some Cognitive Domains in Newly Diagnosed Epileptic Patients N/A
Completed NCT03994718 - Creative Arts II Study N/A
Recruiting NCT04076449 - Quantitative Susceptibility Biomarker and Brain Structural Property for Cerebral Cavernous Malformation Related Epilepsy
Completed NCT00782249 - Trial Comparing Different Stimulation Paradigms in Patients Treated With Vagus Nerve Stimulation for Refractory Epilepsy N/A
Completed NCT03683381 - App-based Intervention for Treating Insomnia Among Patients With Epilepsy N/A
Recruiting NCT05101161 - Neurofeedback Using Implanted Deep Brain Stimulation Electrodes N/A
Active, not recruiting NCT06034353 - Impact of Pharmacist-led Cognitive Behavioral Intervention on Adherence and Quality of Life of Epileptic Patients N/A
Recruiting NCT05769933 - Bridging Gaps in the Neuroimaging Puzzle: New Ways to Image Brain Anatomy and Function in Health and Disease Using Electroencephalography and 7 Tesla Magnetic Resonance Imaging
Not yet recruiting NCT06408428 - Glioma Intraoperative MicroElectroCorticoGraphy N/A
Not yet recruiting NCT05559060 - Comorbidities of Epilepsy(Cognitive and Psychiatric Dysfunction)
Completed NCT02977208 - Impact of Polymorphisms of OCT2 and OCTN1 on the Kinetic Disposition of Gabapentin in Patients Undergoing Chronic Use Phase 4
Completed NCT02952456 - Phenomenological Approach of Epilepsy in Patients With Epilepsy
Completed NCT02646631 - Behavioral and Educational Tools to Improve Epilepsy Care N/A
Recruiting NCT02539134 - TAK-935 Multiple Rising Dose Study in Healthy Participants Phase 1
Completed NCT02491073 - Study to Evaluate Serum Free Thyroxine (FT4) and Free Triiodothyronine (FT3) Measurements for Subjects Treated With Eslicarbazeine Acetate (ESL) N/A
Terminated NCT02757547 - Transcranial Magnetic Stimulation for Epilepsy N/A