Clinical Trials Logo

Clinical Trial Details — Status: Not yet recruiting

Administrative data

NCT number NCT04827628
Other study ID # 1803211718
Secondary ID
Status Not yet recruiting
Phase N/A
First received
Last updated
Start date April 10, 2021
Est. completion date June 1, 2021

Study information

Verified date April 2021
Source Hasanuddin University
Contact Bumi Herman, Ph.D
Phone +66638275008
Email bumiherman@med.unhas.ac.id
Is FDA regulated No
Health authority
Study type Interventional

Clinical Trial Summary

Background : Obesity prevalence rises among adults and leads to morbidity and mortality due to subsequent inflammation pathway activation. This activation is induced by higher lipid consumption which activates the Nuclear factor kappa-light-chain-enhancer of activated B cells (NF-kB) pathway and alters the microbiota profile. The Oryza sativa extract contains anthocyanin which possibly affects the microbiota composition and NF-kb pathway which eventually preserves the protective layer and tight junction of the epithelial cells. Therefore it is important to address the impact of this extract on these parameters. Objective : To assess the effect of Oryza sativa extract on microbiota profile (Lactobacillus, Firmicutes, Bacteroides, Bifidobacteria, and Escherichia coli), Lipopolysaccharide/ LPS, and the tight epithelial junction (Zonula Occludens-1) among obese adults. Method: A two-arm Quasi-Experimental will be conducted, followed by two repeated measurements, at the baseline and 3 weeks after intervention Hypothesis: Oryza sativa extract lowers the LPS level, Firmicutes sp, Bacteroides sp, and increases ZO1 protein, Bifidobacteria, and Lactobacillus sp.


Description:

Method: 1. Non Randomized clinical trial with double-blind 2. Participants will be recruited consecutively 3. Matching technique will be applied following several variables adjustment 4. Two-arm of the group participants are the normal group, the obese control group, and the obese intervention group Sample size calculation: The difference between two independent means sample size calculation is applied following the elements below: a. Type 1 error: 10% b. Power: 80% c. Effect Size: 0.9 (based on changes of LPS value) d. Dropout rate: 20% e. Hypothesis: Superiority Trial g. The number of participants per group: 14 Intervention : 1. Extract: Liquid extract of Oryza sativa derived from 10 grams of Oryza sativa fine powder. The powder is mixed with 100 ml ethanol 50% and 0.5 ml of hydrochloric acid (HCl) in 300 C for 2 hours. A supernatant is extracted and evaporated at 35 C and dried and 60 C to remove any dissolving agents. This yields an extract of 624.27 mg. 2. Anthocyanin level is measured using a spectrophotometer where 20 microliters of extract added to 2 mL Potassium Chloride (KCl) (with pH 1.0) and 2 ml Sodium Acetate (NaCH3COO) (pH 4.5). Absorption of 500 nm and 700 nm waves are measured and calculated using the cyanide-3-glucoside calculation where : anthocyanin level : (absorbance x 449.2 x dilution factor x 1000) / 26.9 Control a. Active comparator using citric acid and sorbitol mixture Biological sample: 1. Serum sample preparation : Participants should undergo fasting for 12 hours. Blood is drawn from the cubital vein to the plain tube and incubated for 30-45 minutes. Centrifugation of sample is done for 15 minutes with 3000 rotation per minute to yield the serum. The supernatant then extracted and stored at -80 C. 2. Feces primary Polymerase Chain Reaction (PCR) using 100-gram feces. The PCR primer for intestinal microbiota are enlisted below : 1. Total intestinal microbiota (ACTCCTACGGGAGGCAGCAGT ATTACCGCGGCTGCTGGC), 2. Firmicutes-Lactobacillus (TACATCCCAACTCCAGAACGAAGCAACAGTACCACGACC)), 3. Bacteroidetes-Bacteroides fragilis (ATAGCCTTCGAAAGRAAGATCCAGTATCAACTGCAATTTTA), 4. Actinobacteria-Bifidobacterium (CTCCTGGAAACGGGGTGGGGTGTTCTTCCCGATATCTACA), 5. Proteobacteria-E.Coli (CATGCCGCGTGTATGAAGAACGGGTAACGTCAATGAGCAAA) Protection of Human subject according to Helsinki Declaration 1. Participants are allowed to receive the information of research including purpose, possible intervention, and side effects. 2. Possible side effect including : 3. Participants are allowed to withdraw from the study for any reason. Statistical Analysis Plan 1. Descriptive statistic of the baseline 2. The bivariate analysis between all variables and the outcomes 3. Paired t-test is intended to see the difference between microbiota profile, LPS, and ZO1 within groups 4. The independent-test to measure the difference in microbiota profile, LPS, and ZO1 value between groups 5. Alternative statistical test: Linear mixed model to adjust the fixed and random effects.


Recruitment information / eligibility

Status Not yet recruiting
Enrollment 42
Est. completion date June 1, 2021
Est. primary completion date May 1, 2021
Accepts healthy volunteers Accepts Healthy Volunteers
Gender Male
Age group 18 Years to 21 Years
Eligibility Inclusion Criteria 1. No consumption of the antioxidant supplement 2. No consumption of prebiotic and probiotic 3. Currently not undergo specific diet Exclusion Criteria 1. Current smoker 2. Diagnosed with chronic diseases 3. Patients with altered kidney and liver function 4. Unable to participate for any reason

Study Design


Related Conditions & MeSH terms


Intervention

Dietary Supplement:
Oryza Sativa Extract
The product is a suspension of 5.6 gram/100 mL given once daily, contains 71.9%, purple in color, range pH 3-5. Stored in the darker bottle. The frequency of administration is once-daily after the meal.
Control
citric acid 0.1g/oz and 1% sorbitol mixture, given once daily after meal

Locations

Country Name City State
Indonesia Hasanuddin University Medical Research Center / HUMRC Makassar South Sulawesi

Sponsors (1)

Lead Sponsor Collaborator
Hasanuddin University

Country where clinical trial is conducted

Indonesia, 

References & Publications (11)

Aguirre M, Venema K. Does the Gut Microbiota Contribute to Obesity? Going beyond the Gut Feeling. Microorganisms. 2015 Apr 27;3(2):213-35. doi: 10.3390/microorganisms3020213. Review. — View Citation

Angelakis E, Armougom F, Million M, Raoult D. The relationship between gut microbiota and weight gain in humans. Future Microbiol. 2012 Jan;7(1):91-109. doi: 10.2217/fmb.11.142. Review. — View Citation

Bae IY, An JS, Oh IK, Lee HG. Optimized preparation of anthocyanin-rich extract from black rice and its effects on in vitro digestibility. Food Sci Biotechnol. 2017 Aug 28;26(5):1415-1422. doi: 10.1007/s10068-017-0188-x. eCollection 2017. — View Citation

Hersoug LG, Møller P, Loft S. Gut microbiota-derived lipopolysaccharide uptake and trafficking to adipose tissue: implications for inflammation and obesity. Obes Rev. 2016 Apr;17(4):297-312. doi: 10.1111/obr.12370. Epub 2015 Dec 29. Review. — View Citation

Igwe EO, Charlton KE, Probst YC, Kent K, Netzel ME. A systematic literature review of the effect of anthocyanins on gut microbiota populations. J Hum Nutr Diet. 2019 Feb;32(1):53-62. doi: 10.1111/jhn.12582. Epub 2018 Jul 8. — View Citation

Ito VC, Lacerda LG. Black rice (Oryza sativa L.): A review of its historical aspects, chemical composition, nutritional and functional properties, and applications and processing technologies. Food Chem. 2019 Dec 15;301:125304. doi: 10.1016/j.foodchem.2019.125304. Epub 2019 Jul 31. Review. — View Citation

Lee B, Moon KM, Kim CY. Tight Junction in the Intestinal Epithelium: Its Association with Diseases and Regulation by Phytochemicals. J Immunol Res. 2018 Dec 16;2018:2645465. doi: 10.1155/2018/2645465. eCollection 2018. Review. — View Citation

Min SW, Ryu SN, Kim DH. Anti-inflammatory effects of black rice, cyanidin-3-O-beta-D-glycoside, and its metabolites, cyanidin and protocatechuic acid. Int Immunopharmacol. 2010 Aug;10(8):959-66. — View Citation

Morais CA, de Rosso VV, Estadella D, Pisani LP. Anthocyanins as inflammatory modulators and the role of the gut microbiota. J Nutr Biochem. 2016 Jul;33:1-7. doi: 10.1016/j.jnutbio.2015.11.008. Epub 2015 Nov 26. Review. — View Citation

Tan J, Li Y, Hou DX, Wu S. The Effects and Mechanisms of Cyanidin-3-Glucoside and Its Phenolic Metabolites in Maintaining Intestinal Integrity. Antioxidants (Basel). 2019 Oct 12;8(10). pii: E479. doi: 10.3390/antiox8100479. Review. — View Citation

Tehrani AB, Nezami BG, Gewirtz A, Srinivasan S. Obesity and its associated disease: a role for microbiota? Neurogastroenterol Motil. 2012 Apr;24(4):305-11. doi: 10.1111/j.1365-2982.2012.01895.x. Epub 2012 Feb 20. Review. — View Citation

* Note: There are 11 references in allClick here to view all references

Outcome

Type Measure Description Time frame Safety issue
Primary Lipopolysaccharide (LPS) level of Serum Measured using Enzyme-Linked Immunosorbent Assay (ELISA) Changes of LPS value from baseline to the last day of intervention (three weeks)
Primary Microbiota Level in Stool sample Measured using primary PCR of total microbiota, Firmicutes-Lactobacillus, Bacteroidetes-Bacteroides fragilis, Actinobacteria-Bifidobacterium and Proteobacteria-E.Coli Changes of Microbiota value from baseline to the last day of intervention (three weeks)
Secondary Zonula Occludens 1 (ZO1) serum level Measured using Enzyme-Linked Immunosorbent Assay (ELISA) Changes of ZO1 value from baseline to the last day of intervention (three weeks)
See also
  Status Clinical Trial Phase
Recruiting NCT04243317 - Feasibility of a Sleep Improvement Intervention for Weight Loss and Its Maintenance in Sleep Impaired Obese Adults N/A
Recruiting NCT04101669 - EndoBarrier System Pivotal Trial(Rev E v2) N/A
Terminated NCT03772886 - Reducing Cesarean Delivery Rate in Obese Patients Using the Peanut Ball N/A
Completed NCT03640442 - Modified Ramped Position for Intubation of Obese Females. N/A
Completed NCT04506996 - Monday-Focused Tailored Rapid Interactive Mobile Messaging for Weight Management 2 N/A
Recruiting NCT06019832 - Analysis of Stem and Non-Stem Tibial Component N/A
Active, not recruiting NCT05891834 - Study of INV-202 in Patients With Obesity and Metabolic Syndrome Phase 2
Active, not recruiting NCT05275959 - Beijing (Peking)---Myopia and Obesity Comorbidity Intervention (BMOCI) N/A
Recruiting NCT04575194 - Study of the Cardiometabolic Effects of Obesity Pharmacotherapy Phase 4
Completed NCT04513769 - Nutritious Eating With Soul at Rare Variety Cafe N/A
Withdrawn NCT03042897 - Exercise and Diet Intervention in Promoting Weight Loss in Obese Patients With Stage I Endometrial Cancer N/A
Completed NCT03644524 - Heat Therapy and Cardiometabolic Health in Obese Women N/A
Recruiting NCT05917873 - Metabolic Effects of Four-week Lactate-ketone Ester Supplementation N/A
Active, not recruiting NCT04353258 - Research Intervention to Support Healthy Eating and Exercise N/A
Completed NCT04507867 - Effect of a NSS to Reduce Complications in Patients With Covid-19 and Comorbidities in Stage III N/A
Recruiting NCT03227575 - Effects of Brisk Walking and Regular Intensity Exercise Interventions on Glycemic Control N/A
Completed NCT01870947 - Assisted Exercise in Obese Endometrial Cancer Patients N/A
Recruiting NCT06007404 - Understanding Metabolism and Inflammation Risks for Diabetes in Adolescents
Recruiting NCT05972564 - The Effect of SGLT2 Inhibition on Adipose Inflammation and Endothelial Function Phase 1/Phase 2
Recruiting NCT05371496 - Cardiac and Metabolic Effects of Semaglutide in Heart Failure With Preserved Ejection Fraction Phase 2