Epilepsy Clinical Trial
Official title:
Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children
| NCT number | NCT05269901 |
| Other study ID # | 2022/2/21 |
| Secondary ID | |
| Status | Completed |
| Phase | |
| First received | |
| Last updated | |
| Start date | January 20, 2021 |
| Est. completion date | January 1, 2022 |
| Verified date | February 2022 |
| Source | Affiliated Hospital of Jiangnan University |
| Contact | n/a |
| Is FDA regulated | No |
| Health authority | |
| Study type | Observational |
Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.
| Status | Completed |
| Enrollment | 40 |
| Est. completion date | January 1, 2022 |
| Est. primary completion date | November 15, 2021 |
| Accepts healthy volunteers | Accepts Healthy Volunteers |
| Gender | All |
| Age group | 6 Years to 12 Years |
| Eligibility | Seizure group Inclusion Criteria: 1. Aged between 6 and 12 years old 2. Newly diagnosed untreated epilepsy Exclusion Criteria: 1. Treated with medicine or another therapy 2. Had history of cancer diseases 3. Had history of endocrine diseases Healthy control group Inclusion Criteria: 1. Aged between 6 and 12 years old Exclusion Criteria: 1. Had history of epilepsy 2. Had history of cancer diseases 3. Had history of endocrine diseases |
| Country | Name | City | State |
|---|---|---|---|
| China | Affiliated Hospital of JiangNan University, Department of Pediatrics | Wuxi | Jiangsu |
| Lead Sponsor | Collaborator |
|---|---|
| Affiliated Hospital of Jiangnan University |
China,
| Type | Measure | Description | Time frame | Safety issue |
|---|---|---|---|---|
| Primary | Rt-qPCR | Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:
GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC |
Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year. | |
| Secondary | Western blot | Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53. | Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year. |
| Status | Clinical Trial | Phase | |
|---|---|---|---|
| Completed |
NCT04595513 -
Stopping TSC Onset and Progression 2: Epilepsy Prevention in TSC Infants
|
Phase 1/Phase 2 | |
| Completed |
NCT02909387 -
Adapting Project UPLIFT for Blacks in Georgia
|
N/A | |
| Completed |
NCT05552924 -
Self Acupressure on Fatigue and Sleep Quality in Epilepsy Patients
|
N/A | |
| Terminated |
NCT01668654 -
Long-term, Open-label Safety Extension Study of Retigabine/Ezogabine in Pediatric Subjects (>= 12 Years Old) With POS or LGS
|
Phase 3 | |
| Not yet recruiting |
NCT05068323 -
Impact of Interictal Epileptiform Activity on Some Cognitive Domains in Newly Diagnosed Epileptic Patients
|
N/A | |
| Completed |
NCT03994718 -
Creative Arts II Study
|
N/A | |
| Recruiting |
NCT04076449 -
Quantitative Susceptibility Biomarker and Brain Structural Property for Cerebral Cavernous Malformation Related Epilepsy
|
||
| Completed |
NCT00782249 -
Trial Comparing Different Stimulation Paradigms in Patients Treated With Vagus Nerve Stimulation for Refractory Epilepsy
|
N/A | |
| Completed |
NCT03683381 -
App-based Intervention for Treating Insomnia Among Patients With Epilepsy
|
N/A | |
| Recruiting |
NCT05101161 -
Neurofeedback Using Implanted Deep Brain Stimulation Electrodes
|
N/A | |
| Active, not recruiting |
NCT06034353 -
Impact of Pharmacist-led Cognitive Behavioral Intervention on Adherence and Quality of Life of Epileptic Patients
|
N/A | |
| Recruiting |
NCT05769933 -
Bridging Gaps in the Neuroimaging Puzzle: New Ways to Image Brain Anatomy and Function in Health and Disease Using Electroencephalography and 7 Tesla Magnetic Resonance Imaging
|
||
| Not yet recruiting |
NCT06408428 -
Glioma Intraoperative MicroElectroCorticoGraphy
|
N/A | |
| Not yet recruiting |
NCT05559060 -
Comorbidities of Epilepsy(Cognitive and Psychiatric Dysfunction)
|
||
| Completed |
NCT02977208 -
Impact of Polymorphisms of OCT2 and OCTN1 on the Kinetic Disposition of Gabapentin in Patients Undergoing Chronic Use
|
Phase 4 | |
| Completed |
NCT02646631 -
Behavioral and Educational Tools to Improve Epilepsy Care
|
N/A | |
| Completed |
NCT02952456 -
Phenomenological Approach of Epilepsy in Patients With Epilepsy
|
||
| Recruiting |
NCT02539134 -
TAK-935 Multiple Rising Dose Study in Healthy Participants
|
Phase 1 | |
| Completed |
NCT02491073 -
Study to Evaluate Serum Free Thyroxine (FT4) and Free Triiodothyronine (FT3) Measurements for Subjects Treated With Eslicarbazeine Acetate (ESL)
|
N/A | |
| Terminated |
NCT02757547 -
Transcranial Magnetic Stimulation for Epilepsy
|
N/A |