Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Bowel Obstruction

Colorectal Cancer Clinical Trial

Official title:

Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction

Clinical Trial Details — Status: Active, not recruiting

Administrative data

• NCT number: NCT05229822
• Other study ID #: BT-ABO
• Status: Active, not recruiting
• Start date: March 1, 2021
• Est. completion date: December 31, 2023

Study information

• Verified date: October 2023
• Source: Karaganda Medical University
• Contact: n/a
• Is FDA regulated: No
• Study type: Observational

Clinical Trial Summary

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.

Today there are several methods for detecting BT:

1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN);

2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).

The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.

Description:

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.

The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.

The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).

During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.

This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).

Recruitment information / eligibility

• Status: Active, not recruiting
• Enrollment: 150
• Est. completion date: December 31, 2023
• Est. primary completion date: October 31, 2023
• Accepts healthy volunteers: No
• Gender: All
• Age group: 18 Years and older

Eligibility

Inclusion Criteria:

• patients with malignant acute bowel obstruction,

• patients with benign acute bowel obstruction,

• colorectal cancer patients without acute bowel obstruction (planned operations).

Exclusion Criteria:

• age less than 18,

• pregnancy,

• patients with paralytic acute bowel obstruction,

• patients with HIV infection, liver cirrhosis,

• patient with an infectious process due to another pathology.

Related Conditions & MeSH terms

• Colon Tumor
• Colonic Neoplasms
• Colorectal Cancer
• Intestinal Obstruction
• Post-Op Complication
• Postoperative Complications
• Systemic Inflammatory Response Syndrome

Intervention

Diagnostic Test:
• LBP
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
• sCD14-ST
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
• 16s rRNA
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.

Locations

Country	Name	City	State
Kazakhstan	NJSC Karaganda Medical University	Karaganda

Sponsors (2)

Lead Sponsor	Collaborator
Karaganda Medical University	Ministry of Education and Science, Republic of Kazakhstan

Country where clinical trial is conducted

Kazakhstan, 

References & Publications (19)

Chiu HC, Lin YC, Hsieh HM, Chen HP, Wang HL, Wang JY. The impact of complications on prolonged length of hospital stay after resection in colorectal cancer: A retrospective study of Taiwanese patients. J Int Med Res. 2017 Apr;45(2):691-705. doi: 10.1177/0300060516684087. Epub 2017 Feb 7. — View Citation

Endo S, Suzuki Y, Takahashi G, Shozushima T, Ishikura H, Murai A, Nishida T, Irie Y, Miura M, Iguchi H, Fukui Y, Tanaka K, Nojima T, Okamura Y. Presepsin as a powerful monitoring tool for the prognosis and treatment of sepsis: a multicenter prospective study. J Infect Chemother. 2014 Jan;20(1):30-4. doi: 10.1016/j.jiac.2013.07.005. Epub 2013 Dec 11. — View Citation

Fang L, Xu Z, Wang GS, Ji FY, Mei CX, Liu J, Wu GM. Directed evolution of an LBP/CD14 inhibitory peptide and its anti-endotoxin activity. PLoS One. 2014 Jul 15;9(7):e101406. doi: 10.1371/journal.pone.0101406. eCollection 2014. — View Citation

Gore RM, Silvers RI, Thakrar KH, Wenzke DR, Mehta UK, Newmark GM, Berlin JW. Bowel Obstruction. Radiol Clin North Am. 2015 Nov;53(6):1225-40. doi: 10.1016/j.rcl.2015.06.008. — View Citation

Hosomi S, Yamagami H, Itani S, Yukawa T, Otani K, Nagami Y, Tanaka F, Taira K, Kamata N, Tanigawa T, Shiba M, Watanabe T, Fujiwara Y. Sepsis Markers Soluble IL-2 Receptor and Soluble CD14 Subtype as Potential Biomarkers for Complete Mucosal Healing in Patients With Inflammatory Bowel Disease. J Crohns Colitis. 2018 Jan 5;12(1):87-95. doi: 10.1093/ecco-jcc/jjx124. — View Citation

Kell DB, Pretorius E. On the translocation of bacteria and their lipopolysaccharides between blood and peripheral locations in chronic, inflammatory diseases: the central roles of LPS and LPS-induced cell death. Integr Biol (Camb). 2015 Nov;7(11):1339-77. doi: 10.1039/c5ib00158g. — View Citation

Levy M, Kolodziejczyk AA, Thaiss CA, Elinav E. Dysbiosis and the immune system. Nat Rev Immunol. 2017 Apr;17(4):219-232. doi: 10.1038/nri.2017.7. Epub 2017 Mar 6. — View Citation

MacFie J, Reddy BS, Gatt M, Jain PK, Sowdi R, Mitchell CJ. Bacterial translocation studied in 927 patients over 13 years. Br J Surg. 2006 Jan;93(1):87-93. doi: 10.1002/bjs.5184. — View Citation

Mussap M, Noto A, Fravega M, Fanos V. Soluble CD14 subtype presepsin (sCD14-ST) and lipopolysaccharide binding protein (LBP) in neonatal sepsis: new clinical and analytical perspectives for two old biomarkers. J Matern Fetal Neonatal Med. 2011 Oct;24 Suppl 2:12-4. doi: 10.3109/14767058.2011.601923. — View Citation

Piton G, Capellier G. Biomarkers of gut barrier failure in the ICU. Curr Opin Crit Care. 2016 Apr;22(2):152-60. doi: 10.1097/MCC.0000000000000283. — View Citation

Roses RE, Folkert IW, Krouse RS. Malignant Bowel Obstruction: Reappraising the Value of Surgery. Surg Oncol Clin N Am. 2018 Oct;27(4):705-715. doi: 10.1016/j.soc.2018.05.010. Epub 2018 Jul 21. — View Citation

Shwaartz C, Fields AC, Prigoff JG, Aalberg JJ, Divino CM. Should patients With obstructing colorectal cancer have proximal diversion? Am J Surg. 2017 Apr;213(4):742-747. doi: 10.1016/j.amjsurg.2016.08.005. Epub 2016 Sep 2. — View Citation

Simillis C, Kalakouti E, Afxentiou T, Kontovounisios C, Smith JJ, Cunningham D, Adamina M, Tekkis PP. Primary Tumor Resection in Patients with Incurable Localized or Metastatic Colorectal Cancer: A Systematic Review and Meta-analysis. World J Surg. 2019 Jul;43(7):1829-1840. doi: 10.1007/s00268-019-04984-2. — View Citation

Stehle JR Jr, Leng X, Kitzman DW, Nicklas BJ, Kritchevsky SB, High KP. Lipopolysaccharide-binding protein, a surrogate marker of microbial translocation, is associated with physical function in healthy older adults. J Gerontol A Biol Sci Med Sci. 2012 Nov;67(11):1212-8. doi: 10.1093/gerona/gls178. Epub 2012 Sep 7. — View Citation

Stubljar D, Skvarc M. Effective Strategies for Diagnosis of Systemic Inflammatory Response Syndrome (SIRS) due to Bacterial Infection in Surgical Patients. Infect Disord Drug Targets. 2015;15(1):53-6. doi: 10.2174/1871526515666150320161804. — View Citation

Taylor MR, Lalani N. Adult small bowel obstruction. Acad Emerg Med. 2013 Jun;20(6):528-44. doi: 10.1111/acem.12150. — View Citation

Tsujimoto H, Ono S, Mochizuki H. Role of translocation of pathogen-associated molecular patterns in sepsis. Dig Surg. 2009;26(2):100-9. doi: 10.1159/000206143. Epub 2009 Mar 2. — View Citation

van Maldeghem I, Nusman CM, Visser DH. Soluble CD14 subtype (sCD14-ST) as biomarker in neonatal early-onset sepsis and late-onset sepsis: a systematic review and meta-analysis. BMC Immunol. 2019 Jun 3;20(1):17. doi: 10.1186/s12865-019-0298-8. — View Citation

Wancata LM, Abdelsattar ZM, Suwanabol PA, Campbell DA Jr, Hendren S. Outcomes After Surgery for Benign and Malignant Small Bowel Obstruction. J Gastrointest Surg. 2017 Feb;21(2):363-371. doi: 10.1007/s11605-016-3307-8. Epub 2016 Oct 25. — View Citation

* Note: There are 19 references in all — Click here to view all references

Outcome

Type	Measure	Description	Time frame	Safety issue
Primary	Change in number of Participants with Post-operative infectious and inflammatory complications	?ny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, ?bdominal abscesses, peritonitis, sepsis, etc.)	day 3, day 7, day 10
Secondary	LBP level in serum blood	LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.	1 hour before surgery, 24 hours after surgery, 72 hours after surgery
Secondary	sCD14-ST level in serum blood	sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.	1 hour before surgery, 24 hours after surgery, 72 hours after surgery
Secondary	16s rRNA in mesenteric lymph nodes	Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.	Once (MLN sampling in sterile conditions during surgery)

External Links

•   Masson S, Caironi P, Fanizza C, Thomae R, Bernasconi R, Noto A, Oggioni R, Pasetti GS, Romero M, Tognoni G, Latini R, Gattinoni L. Circulating presepsin (soluble CD14 subtype) as a marker of host response in patients with severe sepsis or septic shock
•   Mierzchala M, Krzystek-Korpacka M, Gamian A, Durek G. Quantitative indices of dynamics in concentrations of lipopolysaccharide-binding protein (LBP) as prognostic factors in severe sepsis/septic shock patients - Comparison with CRP and procalcitonin /