Clinical Trials Logo

Clinical Trial Summary

Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs. Today there are several methods for detecting BT: 1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN); 2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST). The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.


Clinical Trial Description

For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications. The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad. The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC). During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used. This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597). ;


Study Design


Related Conditions & MeSH terms


NCT number NCT05229822
Study type Observational
Source Karaganda Medical University
Contact
Status Active, not recruiting
Phase
Start date March 1, 2021
Completion date December 31, 2023

See also
  Status Clinical Trial Phase
Suspended NCT05400122 - Natural Killer (NK) Cells in Combination With Interleukin-2 (IL-2) and Transforming Growth Factor Beta (TGFbeta) Receptor I Inhibitor Vactosertib in Cancer Phase 1
Active, not recruiting NCT05551052 - CRC Detection Reliable Assessment With Blood
Completed NCT00098787 - Bevacizumab and Oxaliplatin Combined With Irinotecan or Leucovorin and Fluorouracil in Treating Patients With Metastatic or Recurrent Colorectal Cancer Phase 2
Recruiting NCT06037954 - A Study of Mental Health Care in People With Cancer N/A
Recruiting NCT05425940 - Study of XL092 + Atezolizumab vs Regorafenib in Subjects With Metastatic Colorectal Cancer Phase 3
Suspended NCT04595604 - Long Term Effect of Trimodal Prehabilitation Compared to ERAS in Colorectal Cancer Surgery. N/A
Completed NCT03414125 - Effect of Mailed Invites of Choice of Colonoscopy or FIT vs. Mailed FIT Alone on Colorectal Cancer Screening N/A
Completed NCT02963831 - A Study to Investigate ONCOS-102 in Combination With Durvalumab in Subjects With Advanced Peritoneal Malignancies Phase 1/Phase 2
Recruiting NCT05489211 - Study of Dato-Dxd as Monotherapy and in Combination With Anti-cancer Agents in Patients With Advanced Solid Tumours (TROPION-PanTumor03) Phase 2
Terminated NCT01847599 - Educational Intervention to Adherence of Patients Treated by Capecitabine +/- Lapatinib N/A
Completed NCT05799976 - Text Message-Based Nudges Prior to Primary Care Visits to Increase Care Gap Closure N/A
Recruiting NCT03874026 - Study of Folfiri/Cetuximab in FcGammaRIIIa V/V Stage IV Colorectal Cancer Patients Phase 2
Active, not recruiting NCT03170960 - Study of Cabozantinib in Combination With Atezolizumab to Subjects With Locally Advanced or Metastatic Solid Tumors Phase 1/Phase 2
Completed NCT03181334 - The C-SPAN Coalition: Colorectal Cancer Screening and Patient Navigation N/A
Completed NCT03167125 - Participatory Research to Advance Colon Cancer Prevention N/A
Recruiting NCT04258137 - Circulating DNA to Improve Outcome of Oncology PatiEnt. A Randomized Study N/A
Not yet recruiting NCT05775146 - SBRT of Metastases Following Neo-adjuvant Treatment for Colorectal Cancer With Synchronous Liver Metastases Phase 2
Recruiting NCT05568420 - A Study of the Possible Effects of Medication on Young Onset Colorectal Cancer (YOCRC)
Recruiting NCT02972541 - Neoadjuvant Chemotherapy Verse Surgery Alone After Stent Placement for Obstructive Colonic Cancer N/A
Completed NCT02876224 - Study of Cobimetinib in Combination With Atezolizumab and Bevacizumab in Participants With Gastrointestinal and Other Tumors Phase 1