Clinical Trial Details
— Status: Completed
Administrative data
| NCT number |
NCT04309019 |
| Other study ID # |
108080 |
| Secondary ID |
|
| Status |
Completed |
| Phase |
|
| First received |
|
| Last updated |
|
| Start date |
March 10, 2020 |
| Est. completion date |
December 31, 2020 |
Study information
| Verified date |
April 2022 |
| Source |
Tungs' Taichung Metroharbour Hospital |
| Contact |
n/a |
| Is FDA regulated |
No |
| Health authority |
|
| Study type |
Observational
|
Clinical Trial Summary
Chronic constipation is a prevalent, multifactorial gastrointestinal disorder, and its
etiology and pathophysiology remain poorly understood. Recently studies using 16S rDNA-based
microbiota profiling have demonstrated dysbiosis of gut microbiota in chronic constipation.
In addition, alterations of fecal flora of the a group of severely constipated patients had
been reported. Constipation, an indicator of gut dysbiosis in dialysis patients, may also
pose a greater burden in dialysis patients. Some recent findings highlight the plausible link
between the gut and the kidneys and provide additional insights into the pathogenesis of
kidney disease progression and development of cardiovascular disease. Yet, the constipation
in dialysis patients is usually ignored and not even draw the attention of dialysis physician
as an ominous risk factor of constipated dialysis patients. In view of multiple factors link
the gut and cardiorenal pathophysiology, and the scarcity of literature on this issue, the
aim of this study is want to know if constipation can result in any changes to the intestinal
microbiota and is it associated with inflammation, atherogenic profile and levels of
microbial derived uremic toxins. Here, the investigators use both self-reported Bristol stool
form scale (BSFS) scores and Roman IV criteria to diagnose constipation and 16S rDNA Illumina
amplicon profiles of faecal samples of 90 dialysis patients to assess potential associations
between microbiota composition and constipation. The relationship between uremic toxins and
inflammation will also be explored in the dialysis suffering from constipation.
Description:
Study Design and Population
Patients and Methods
This study will include 90 dialysis patients. Patients over age 20 years old and undergoing
HD for at least 6 months will be enrolled. Patients with inflammatory diseases, cancer, AIDS,
autoimmune disease, use of a central catheter for hemodialysis access, amputated limbs,
pregnancy, and patients using catabolic drugs, antioxidant vitamin supplements pre, pro and
symbiotic and antibiotics in the last 3 months before the start of this study were excluded.
Dialysis duration was 4 hours per session, three times per week, with a blood flow >250
mL/min and a dialysate flow of 500 mL/min.
Analytic Procedures and Sample Processing
Blood samples will be drawn from each subject in the morning, after overnight fasting (for HD
patients before a regular HD session). Plasma was separated (15 minutes, 30003 g, 4 C) and
stored in -80 C until analysis.
Total concentrations of uremic toxins indoxyl sulfate(IS), p-cresol sulfate(PCS), and
indoleacetic acid( IAA) are quantified by high-performance liquid chromatography (HPLC) with
fluorescent detection.. Briefly, for binding competition, 200μl serum to which we added 20μl
0.50mM 1-naphthalenesulfonic acid (internal standard) was vortex-mixed with 250μl 0.24M
sodium octanoate (binding competitor).After incubation at room temperature for 5min, we added
2ml cold acetone to precipitate proteins. Following vortex-mixing and centrifuging at 4 ◦C,
1860×g for 20 min, the supernatant was transferred to 12mm×100mm, GL 14 glass test tubes and
2ml dichloromethane was added. After vortex-mixing and centrifuging at 4 ◦C, 1860×g for
10min, 200μl of the upper layer was transferred to glass autosampler vials, followed by
addition of 20μl 1M HCl and 15μl was injected onto the HPLC. The HPLC analysis was performed
on an Agilent 1100 series LC (Santa Clara, CA),and Agilent ChemStations software were used
for the chromatographic analysis. The separation was carried out on a ZORBAX SB-C18 Solv
Saver Plus HPLC column (5 μm, 3.0 mm×150 mm).at a flow rate of 0.6 ml/min. Mobile phase A is
0.2% trifluoroacetic acid in Milli-Q water and mobile phase B is 0.2% trifluoroacetic acid in
acetonitrile. The analytical method consists of an isocratic run with 92% mobile phase A for
23 min.. Each analytical run was followed by a 1.3 min washout gradient to 100% B. Column
temperature was 25 ◦C, and autosampler tray temperature was 6 ◦C. We quantified the analytes
by using the analyte to standard peak area ratio on a Agilent 1100 High Performance
Fluorescence detector G1321A and Agilent 1100 Series UV-Visible detectors G1314A. Detector
settings were λex 260 nm/λem288nm for p-cresyl sulfate and λex 280 nm/λem 390nm for indoxyl
sulfate and IAA.
Total antioxidant activity (TAA) is measured in plasma using the Antioxidant Status Assay Kit
(Calbiochem, Darmstadt, Germany) according to the manufacturer's protocol. The assay is
defined as the ability of antioxidants in the plasma samples to prevent oxidation of
2,2'-azino-bis-(3-ethylbenz-thiazoline-6-sulfonic acid) (ABTS) by metmyoglobin. The amount of
ABTS+ produced is monitored by reading the absorbance at 600 nm. The inter- and intra-assay
coefficients of variation are 5.0% and 4.3%, respectively.
High-sensitivity protein C reactive (CRP), interleukin- 6 (IL-6), MCP-1, and Calprotectin
were analyzed by immunoenzymatic assay (ELISA; R&D systems ). Routine laboratory parameters
were measured by standard techniques.
Laboratory measurements
Total Antioxidant Status (TAS) kits purchased from Randox Laboratories Ltd. (Crumlin, UK) are
applied for the assessment of the overall serum antioxidant capacity. It is based on the
suppression of the formation of 2,2'-azinobis (3-ethylbenzothiazoline-6-sulfonate; ABTS*+),
mediated mainly by the subsequent antioxidants: uric acid, protein thiol groups, ascorbic
acid, and tocopherol. The plasma levels of MCP-1, IL-6, CRP, IL-17A and calprotectin are
tested by commercially available human ELISA kit respectively, according to the
manufacturer's instruction.
Stool DNA Isolation and 16S rDNA Gene Amplicon Sequencing
QI Aamp DNA Stool Mini Kit (51504; Qiagen, Germantown, MD) is used to extract gDNA from
freshly collected feces samples from both mouse strains. The 16S rDNA gene variable regions
V3-V6 are amplified by PCR using fecal gDNA. PCR comprised two consecutive steps. Primers
targeting the 16S rDNA gene (italic) and specific primers carrying the 59M13/rM13 adapters
(bold) 338FM13 (GTAAACGACGGCCAGTGCTCCTACGGGWGGCAGCAGT) and 1044R-rM13
(GGAAACAGCTATGACCATGACTACGCGCTGACGACARCCATG) are used to amplify the V3-V6 region of the
bacterial 16S rDNA gene. After purification of PCR products using the NucleoSpin Gel and PCR
Clean-Up Kit per the manufacturer's instructions, concentration and quality of the purified
PCR products are assessed. To barcode each PCR product with a specific MID sequence and add
the 454-specific Lib-L tag, a second PCR was performed using M13/rM13-specific primers
containing the 454-specific Lib-L primers (underlined) A-M13 (CCATCTCATCCCTGCGTGTCTCCGACTCAG
/ MIDsequence/GTAAACGACGGCCAGG) and B-rM13 (CCTATCCCCTGTGTGCCTTGGCAGTCTCAGGGAAACAGCTATGA
CCATGA).
Amplicons of the second PCR were pooled and purified by ethanol precipitation. Purified PCR
products are run on a 0.8% agarose gel, bands corresponding to the barcoded 16S rDNA gene
sequences are excised, and DNA was extracted using the NucleoSpin Gel and PCR Clean-Up Kit.
DNA is eluted in ddH2O, further purified using AMPure Beads (Beckman Coulter, Inc., Brea,
CA), and finally, resuspended in ddH2O. Concentration and quality of the purified barcoded
sequences are assessed using a Nanodrop (Peqlab Biotechnology). Samples are stored at 220°C.
Amplicon sequencing is performed at Eurofins on a 454 GS FLX Titanium Platform from one side
(Lib-L-A) according to the recommended procedures for 454 Roche (Roche, Basel, Switzerland).